Sunday, February 4, 2007

Questions from January 24, 2007

1. Same as Q4 from 1/22/07

2. The actual mRNA is the shortest strand, with the coding sequence the second shortest and the pre-mRNA (junk DNA I believe) is the longest by far. (I am not positive about this one, if anyone has another oppinion please post.)

3. complimentary DNA strand:
TACATAGTCTATCTGGCCTGCCATCAACAGACC
corresponding mRNA strand:
AUGUAUCAGAUAGACCGGACGGUAGUUGUCUGG
corresponding peptide:
MetTyrGlnIleAspArgThrValValValTrp

4. If we assume there are 4 linearly arranged nucleic acids in this Martian life form like in all life forms on earth and there are 100 different amino acids in these Martian life forms then the code is based on a 4:1 relationship and is therefore a series of four non overlapping nucleic acids code for a single amino acid. Simple mathematics shows that triplets would only allow for 64 different combinations while quartets would allow for 256 combinations which is more than enough for the 100 different Martian amino acids.

5. (from highest to lowest) skin color, autism, cyctic fibrosis, sexual orientation, left-handedness, intelligence, weight, addicition, religion. (those are just my thoughts, I'd be interested to hear others)

No comments: